NKRYPT sculpture

photograph of installation area

NKRYPT is a cryptography related installation outside the Questacon science exploration centre in Canberra, Australia. It was designed by Stuart Kohlhagen, and installed in March 2013 during the Centenary of Canberra

It consists of eight stainless steel pillars. Each pillar has several stenciled ciphertexts which have been lasercut out of the steel. They are lit both externally and internally.

These pages document progress towards deciphering these pillars. There are many which have yet to be publicly solved. Other NKRYPT related pages include dkrypt.org and the facebook page.

spoilers below

plaque

A plaque on the wall of the forecourt near pillar H introduces the installation.

NKRYPT

Mystery beyond
Decipher the veiled meaning
Renown awaits you

From simple to hard, the key to the last
is found in all the rest.

One code within NKRYPT celebrates Canberra's Centenary.
Be first to decipher it and win a great prize.
For more information: www.questacon.edu.au
Proudly supported by Mr Eddie Kutner and Mr Leon Kemplar

overview

The pillars each have a cipher at about head height, and these can all be represented as a cylinder of 26x5 symbols, which I call the 'ring' ciphers. The lower half of each of the pillars also have a cipher, with a wide variety (except for the tallest pillar, where it is placed above the ring cipher, and is possibly the concluding one). Another cipher is also distributed across the bases of the pillars.

All of the ring ciphers are traversed in labyrinthine fashion. Between each pair of rows, there is only one traversal down and up, and we think that these traversal positions represent settings for the enigma machine on pole C (A=DNOI/DNOV, B=CFEC, C=FHIG, D=HWCJ, E=EFCF, F=CMBH, G=????, H=SMOU).

I have arranged the pillars in order of fiducial spacing, which I have labelled A to H. In other places you will find another numbering scheme; the correspondence is A=7, B=4, C=6, D=2, E=8, F=3, G=5, H=1. Pillar heights are A=1709mm, B=1887mm, C=2153mm, D=2347mm, E=2393mm, F=2379mm, G=2432mm, H=2569mm. The triangular fiducials are facing A=south, B=north, C=north, D=south, E=east, F=west, G=east, H=west. The start of the ring ciphers is usually in line with the fiducial, except E and F (and possibly G) which start at 180 degrees. The triangular fiducials are in pairs on the pillars, with separations of A=0mm, B=116mm, C=354mm, D=571mm, E=628mm, F=636mm, G=655mm, H=786mm.

montage with all eight pillars

The pillars are placed on the west side of Questacon, in a constellation as shown in the scale diagram below.

layout of the pillars

A: geospatial and caesar

35248614916353547101490974
24725391509414892533731941
14909573522681490367353636
41635353213194116435346709
81491040353180149092635377

A sequence of numbers which are latitude and longitude coordinates for locations around Canberra. The first three suburbs are Questacon locations, and the remaining suburbs are connected to Australian scientists and innovators. This was the solution to the Centenary Code challenge.

35.2742S, 149.1373E Ainslie, former location of Questacon
35.2984S, 149.1312E Parkes, Questacon National Science and Technology Centre
35.3180S, 149.0926E Deakin, Questacon Technology Learning Centre
35.3778S, 149.1040E Farrer [wheat breeding pioneer]
35.3536S, 149.0764E Chifley [streets named after scientists]
35.3461S, 149.0367E Rivett [chemist]
35.3636S, 149.0957E Mawson [Antarctic explorer]
35.2268S, 149.0519E Florey [pharmacologist and pathologist]
35.2486S, 149.1635E Hackett [streets named after scientists]
35.4710S, 149.0974E Banks [botanist]

A LETTER SHIFT A CIPHER MAKES
A FAMOUS ROMANS NAME IT TAKES

B MFUUFS TIJGU B DJQIFS NBLFT
B GBNPVT SPNBOT OBNF JU UBLFT

C UJKHV QH VYQ AQW PQY ECP DTGCM
DWV QVJGT OQXGU C EQFG ECP OCMG

KRZHYHU WKHB EH VZDSSHG DERXW
D NXID PDQ FRXOG ILQG WKHP RXW

RPKR QMWJZZKRG WYMABY
INGY PZBZIE XROZA
OPK RNQV SA ENMPL
XVZIZ GBHV ERIQIF

These are various kinds of shift ciphers. The last Vigenere cipher uses the keyword "VIGENERE".

A letter shift a cipher makes
 a famous Roman's name it takes [Caesar]
A shift of two you now can break
 but other moves a code can make [shift]
However they be swapped about
 a Kufa man could find them out [Al-Kindi]
When different shifts
 each letter takes
The name of which
 great code awakes [Vignere]

B: semaphore and scytale

65 45 32 33 42 46 64 64 21 66 46 32 34 64 51 42 31 12 66 33 43 65 33 66 11 51
64 12 64 64 33 42 33 66 32 55 66 41 46 45 33 13 12 64 56 45 34 13 26 66 36 26
45 51 64 64 36 51 66 46 64 51 51 66 41 64 32 34 66 42 31 13 45 33 66 34 34 26
12 64 45 31 26 51 11 66 33 12 12 31 66 51 11 42 33 12 31 42 64 46 42 26 55 11
45 24 56 12 64 46 66 31 12 51 66 51 26 33 45 31 41 64 33 43 64 55 42 46 32 33

This is a Chappe semaphore system, transcribed with a number representing the angle from the centre of the glyph (45, 90, 135, 225, 270, 315).

COPRIMEEXAMPLESINDARKCRABS
EDEERIRAPYAGMORFDEWOLFTAHT
OSEEHSAMESSAGEPLAINFORALLT
DEONTSBARDDNASBIRDNIEMITYB
OVWDEMANDSASTRONGERKEYIMPR

code that flowed from gay Paris
 a message plain for all to see
 now demands a stronger key
improved by time in dribs and drabs
 three prime examples in dark crabs

AGPSHALHALIECNREWTOCTPUWS
MEOLOLOADOEEEOSAAHVHEERIP
EHNAWLSVMFNCRFICCAESRDENA
SIHVNBEEIATETAAEOTDMHEHFR
SDIETYRARNGUAPNSDPMAENIOT
AUSSOCSNACRNIEPAERURLSSRA

This is a scytale wrapped around a hexagonal baton. The plaintext refers to a message of revolt marked on the head of a slave by Histiaeus, and a scytale scroll sent to Lysander of Sparta in 404BC.

A message hid upon his slave
 shown to all by closer shave
an admiral of ancient Greece
 uncertain of a Persian peace
saw a code that proved much smarter
 helped ensure his win for Sparta

C: binary and enigma

MPILLEATSTONEBRANLYBRAUNCA
KOOCOHWYADARAFRAYDARUOMEDE
ILWEBERGINGSTURGEONTESLAVA
OFREHTUAREMMEOSGNILLIHCSDR
ORSERUSSHENRYHERTZMARCONIM

This is a binary code with dashes for 1 and dots for 0. Each character is a 2x3 array, with the bits low order first. The plaintext is a list of scientists and inventors, who worked on electrical telegraphy and wireless telegraphy.

Branly, Braun, Campillo, Cooke, DeMoura, Dyar, Faraday, Gauss, Henry, Hertz, Marconi, Morse, Rutherford, Schilling, Soemmering, Sturgeon, Tesla, Vail, Weber, Wheatstone

diagram of rotor connections

Rotor 1 wiring
ABCDEFGHIJKLMNOPQRSTUVWXYZ
UDBCFGEJHILMKTSNOPQRWXYZAV

Rotor 2 wiring
ABCDEFGHIJKLMNOPQRSTUVWXYZ
BZCXWHIFGLMJKVUPSQRTONEDYA

Rotor 3 wiring
ABCDEFGHIJKLMNOPQRSTUVWXYZ
ZADEFGCHMIJKLOPQRNWSTUVBXY

Rotor 4 wiring
ABCDEFGHIJKLMNOPQRSTUVWXYZ
BDFCEGIJKLSMAZNHOPQRTVXUWY

Reflector wiring
ABCDEFGHIJKLMNOPQRSTUVWXYZ
ZYVMLIHGFKJEDURQPOTSNCXWBA

BIOB AXQC NLPA MNXE SBNT FJLD DL
JAWS FDHD MATX EJHM PVUJ XJOM KH

These are movable rotor wheels with wiring between letters (similar to the Enigma machine). The reflector wheel is fixed. Each have triangular fiducials for alignment of the start position. The advancement sequence is not known. It is possible that the lower ciphertext is some sort of transposition key. Here is a C++ implementation of the encryption.

[unsolved]

D: pigpen and cogs

LUCKVERURCHSIEGINGALLMEING
IENEROLDRIMTELHEFRETHCSOBN
HTUSERKORENDENNMEINETOEWIC
NEAHCINIBESHCONRHITIMHOLFT
ZUMLEIDENHICHSIEZITTERN123

This is a pigpen cipher, with right-to-left lines upside down, and in German. The plaintext is the second quatrain from the first aria performed by the Queen of the Night in Mozart's "Die Zauberflöte". The pigpen cipher was commonly used by the Freemasons, while the opera contains rationalist Freemason motifs.

The '123' of the plaintext might refer to: the three remaining lines of the third quatrain (Erschüttern, Beben, Streben); the three flats of the key; the three chords beginning the overture (E-flat minor, C-minor, E-flat major); the three masonic pillars (wisdom, strength, beauty); the three veiled ladies who attend the queen of the night; and so on.

Zum Leiden bin ich auserkoren
 Denn meine Tochter fehlet mir;
Durch sie ging all mein Gluck verloren
 Ein Bosewicht entfloh mit ihr
Noch seh ich sie zittern.
 1 2 3

I am chosen for suffering,
 for my daughter is gone from me;
Through her all my happiness has been lost,
 a villain fled with her
I can still see her trembling
 1 2 3

[cogs]

[unsolved]

E: braille and railfence

** *· ** *· *· ** *· ** *· ** *· ·* *· *· ·* *· *· *· ·* ·* ·* ** *· ·* *· **
** ·* ·* ·* ·· ·* ·* *· ·· ·* ·· *· *· ·· *· ** ·* ** ** *· *· ** ** ** ·* ·*
·· ·· *· ·· ·· ·· *· ·· ·· *· ·· ·· *· ·· *· ·· *· *· *· *· ·· ·· ·· *· ·· ··

*· ·* ·· ·* ·· ·* ·· ·· ·* ·* ·* ·· ·* ·* ·· ·* ·* ·* ·* ·· ·* ** ·· ·· ·* ··
** ·* ·· ** *· ** ·* *· ·* *· *· ·· ·· ** ·· ·* *· ** ·* *· ·* ·· ·* ** ** ·*
*· ·* ·* ·* ·* ·* ** ** ·* ·* ** ·* ·* ·* ·* ** ·* *· *· ·* *· ·* ·* ·* *· *·

*· ·* *· *· *· *· ** ** *· *· *· *· *· *· *· ·* ·* ·* ·* ·* ** ** ** *· ·* ·*
·* *· ** ·* ** ·* ·* ·· ** *· ·· ** *· ·* ** *· *· ** ** *· ·* ** ** ·· *· **
·· ·· ·· ·· ·· ·· *· ·· ·· ·· ·· *· ·· ·· *· *· ·· *· *· ·· *· ·· *· ** ·· *·

·* ·* ·* ·* ·* ·· ·* ·· ·* ·· ·· ·* ·· ·· ·· ·· ·* ·* ·· ·* ·* ·* ·· ·· ·· ··
** *· ** *· *· ·* ** ** ** *· ** *· ·· ·* ·· ·* *· ·* ·* ** ·· ** ·· *· *· **
*· ** *· ** ·* *· ** ** ·* ·* ** ** ** ** ·* ** ·* ** *· *· ·* ·* ·* ** ·* ·*

·* *· *· *· ·* ** ·· *· ** *· ·* ** *· ·* *· *· *· *· *· *· *· ** *· *· *· ·*
** ·* ** ·· *· ·* ** ·* *· ·· *· ·* ·· *· *· ·· *· *· ·* ·· ** ** ** ·* ·· **
·* *· *· *· *· ·· *· *· ·· ·· *· ·· ·· ·· *· ·· *· *· *· ** *· ·· *· ·· ·· *·

This is a Braille cipher. Lines traversed right-to-left are upside down.

GENEADOFANAILASHORTSIGHTED
WLARERFDLONAKRAPOTSESUBHTI
EIHEHENCHBARBERSITTINGQUIT
TNTNOILGREGNIFAFOPITKRADEH
WORKSDEOFASNAILALLOURGREAT

A short-sighted general with buses to park [Napoleon?]
 an old French Barber sitting quite in the dark [Barbier]
Tip of a finger, glide of a snail [Braille]
 all our great works on the head of a nail.

The lower cipher is a rail fence cipher.

A simple code to hide your tails
it's letters nailed to different rails [rail fence cipher]
A famous scholar from times past
with copper discs encoded fast [Alberti]
A German monk with codes so strong
used keys to shift the cipher on [Trithemius]
A family down the mountainside
a cabinet noir they worked inside [Rossignol]

F: dna and astroids

AGGTAGTTGCTC?AAGCGTGCTAGCT
TCCATCAACGAG?TTCGCACGATCGA
GGGTACGGTCCACCAGGAGGCATACT
CCCATGCCAGGTGGTCCTCCGTATGA
CCCTGTGCGTAAACCGTCTGATGACC
GGGACACGCATTTGGCAGACTACTGG
AAGGCACACGGCCGCTCATACGGTAG
TTCCGTGTGCCGGCGAGTATGCCATC
GTTAGTTACCTTGCGTGCTCTCGGCC
CAATCAATGGAACGCACGAGAGCCGG

These group in 3-letter codons for proteinogenic amino acids. The amino acids each have a 1 letter code. The plaintext may refer to the Australian conservation geneticist Karen Firestone, who worked on the Australian Museum project to recover thylacine DNA.

IINE FARS
GCALYDETH
WEDTHLADY
EETAPSYAM
AINWNAREP

far sighted lady
 we may spawn
 a repainted thylacine

diagram of astroid placement

The astroids are in 42 columns spaced around 22mm apart and with irregular vertical spacing. Each astroid is around 15mm across. They may represent light spectra (eg from stars or elements).

[unsolved]

G: squircles and waveform

01110011011101021231331012
02030013322303333000200032
21221133103032320102000132
23123002121223001301131123
10103100010101201201221103
30212131033000203011112330
30101111212032132012210133
13303323023120222333322012
00000101022001203231310031
30110333202120112302112123

These 'squircles', in appearance like petals or cams, are presumably grouped in vertical pairs to give the standard 26x5 labyrinth grid.

[unsolved]

UWGHTLIYCOEYDY
RFKVOACMHPUCEAL
BANYUJHEESHABPS
NAYIDQGILTIVKTE
FAESOKTMZQDMRGH
HYLHNICNLBNWWXX
KGAPYHIIQHSKETZ
RRENUCMTVUINLZR
ICYRFFGTKDNBQSH
NLXZWKMVCICTCDD
ZAOWRSUNVMDOIXG
ZCCFCUEAKAKFSMP
YRHUUTMCYSSMPFG
TUCIESREQXAICHL
LYVBKNNZVBPKNQA
EXQSHOSGVZDHDFM
HYPHCUDQTMWVNEK
NGACBGTSACXEHRE
DUUHNQVDATWTIEK
ZRFHTOFRUPTKHNP
XYNFBBHWPVSSKIN
NOHYWLJQZKWRSQO
UIEEQKYEMPRQEDM
IVSVAPNGKDVPQME
XGCIOAVXVIGTPIQ
ORDQRJEKWFPVWZP
ECYNYRCGWWIFCYX
GVLGPLBSJGMIJCX
RHYEOHHWTXOAGYS
FSDOZGZJGNPTRUA
ESTRPYFTJVZQHOP
EQLOQRGPHPKEDEI
IQHCZYWPJZKAZQA
KSKMIPLDRGCWCAD
GZCDBB

This consists of 515 characters, split into lines mostly of 15 characters which are spaced and offset so that they look like a helix.

[unsolved]

H: labyrinth and PVL

The top cipher consists of a ring of 26x10 symbols, and the letters 'P', 'V', and 'L' are in a larger font. It has not been solved, and is perhaps the conclusion of the eight ring ciphers.

OXPUWAOEKZVCRLUYFMLXTPNATW
VGZTCGVGDAAXFDKOCRFRUOKAPW
LCMPTFPBTYXRSZKKQUBJAMHYUL
MZVSXXZHDLYHOKWWEJUXLXKRZU
PPESLBOEKOGRTAYDFOHRHVMPBN
DTEZBTYDXNMPXHVNKCIYEMJFVE
MNKDIQBOSUFFFWBVDNKHRTLIMZ
WRRQUFNNBGKUWNQCHDEFSTZZRQ
UIUDPTKGATPSJIFXXGGSNTWJLA
BRYVUCSBNPYAVSTTONZFWIUUNW

[unsolved]

The lower cipher consists of letters which can be traversed labyrinthine style to give the plaintext.

ALABYRINTHSTANDSBEHATAWAIT
EHTHCUORHTPEOYEROFTSAMGINE
ATONEBYONESTUATHEYCREATETH
IEFOENOTUBSIDNSNRETTRAMTHG
ETWISTSANDTURNSFORPAKALLTH

A labyrinth stands before you
 and is but one of eight
Mark all the twists and turns
 for patterns they create
That one by one step through
 the enigmas that await

base code

A 10/11 9/11 9/12 13/17 28/29 15/17 11/12 11/12 11/13 20/24 9/13 11/11 7/9.3 11/11 14/17
B 10/10 9/12 11/13 15/17 28/30 17/18 11/12 8/10 14/15 22/24 12/13 11/12 7/10 8/11 14/17
C 10/10 11/12 11/13 14/15 30/30 17/18 12/12 8/10 14/14 19/22 12/12 11/13 7/7 8/8 14/17
D 10/11 9/14 12/13 15/17 28/30 17/17 11/11 8/12 13/15 22/24 9/13 11/11 9.3/10 8/11 14/17
E 10/11 12/14 11/13 15/22 28/30 16/17 11/13 8/10 12/15 22/22 10/13 11/13 9/10 8/8 16/17
F 10/12 12/14 11/12 14/15 28/30 16/17 11/11 8/10 10/15 19/24 9/12 11/13 9/9.3 8/8 14/17
G 11/12 9/12 11/13 15/17 28/30 17/18 11/11 10/12 13/14 19/24 12/13 11/12 7/9.3 8/11 14/17
H 10/12 11/12 11/11 14/17 30/30 16/18 11/12 10/10 10/14 19/24 12/12 12/13 7/9 8/11 14/14

These appear to represent repeat counts from 15 autosomal-STR loci of DNA, used to genotype people. These are loci measured by systems such as the Powerplex 16 HS. The order is alphabetic (CSF1PO, D13S317, D16S539, D18S51, D21S11, D3S1358, D5S818, D7S820, D8S1179, FGA, PENTAD, PENTAE, TH01, TPOX, VWA). The genotypes are similar, and probably from a European/Asian population group.

If these are genetic relationships, the possible filial connections are A-D, B-C, B-D, B-E, B-H, C-H, D-E, D-F, D-G, F-H, G-H. If we require both parents, then the possible parental connections are AE-D, HD-F, HD-G, and either HD-B or HB-C.

[unsolved]

opening day tweet

On the opening day, Senator Kate Lundy tweeted a message which had been encoded using the enigma cipher. A photograph taken then shows an Enigma setting of CYWE.

HDXJNFJXZJEZTHDBMMWQZJTUROGOUCRFRUOHHZMLQPMBKUYKKCRNKDLNDLXJNIDIHJIHQKWDPCI

With an enigma setting of "SWYQ" (which is rot13 of "FJLD"), the last sixteen letters decode as "thecentenarycode".

[unsolved]